Synj2Bp Antibody Mouse

Lab Reagents

Human IgG antibody Laboratories manufactures the synj2bp antibody mouse reagents distributed by Genprice. The Synj2Bp Antibody Mouse reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact mouse Antibody. Other Synj2Bp products are available in stock. Specificity: Synj2Bp Category: Antibody Group: Mouse

Mouse information

Anti-SYNJ2BP antibody

STJ117664 100 µl
EUR 277

Mouse SYNJ2BP shRNA Plasmid

20-abx973630
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYNJ2BP Recombinant Protein (Mouse)

RP176792 100 ug Ask for price

SYNJ2BP siRNA

20-abx905404
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYNJ2BP siRNA

20-abx935814
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYNJ2BP siRNA

20-abx935815
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYNJ2BP Polyclonal Conjugated Antibody

C28983 100ul
EUR 397

SYNJ2BP Antibody, HRP conjugated

1-CSB-PA023018LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNJ2BP. Recognizes SYNJ2BP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SYNJ2BP Antibody, FITC conjugated

1-CSB-PA023018LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNJ2BP. Recognizes SYNJ2BP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SYNJ2BP Antibody, Biotin conjugated

1-CSB-PA023018LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNJ2BP. Recognizes SYNJ2BP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Synj2bp ORF Vector (Mouse) (pORF)

ORF058932 1.0 ug DNA
EUR 506

SYNJ2BP Rabbit pAb

A15469-100ul 100 ul
EUR 308

SYNJ2BP Rabbit pAb

A15469-200ul 200 ul
EUR 459

SYNJ2BP Rabbit pAb

A15469-20ul 20 ul
EUR 183

SYNJ2BP Rabbit pAb

A15469-50ul 50 ul
EUR 223

SYNJ2BP cloning plasmid

CSB-CL023018HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 438
  • Sequence: atgaacggaagagtggattatttggtcactgaggaagagatcaatcttaccagagggccctcagggctgggcttcaacatcgtcggtgggacagatcagcagtatgtctccaacgacagtggcatctacgtcagccgcatcaaagaaaatggggctgcggccctggatgggcggct
  • Show more
Description: A cloning plasmid for the SYNJ2BP gene.

anti-Anti-SYNJ2BP

YF-PA19694 50 ug
EUR 363
Description: Mouse polyclonal to Anti-SYNJ2BP