Antibodies Rrm2B Mouse

Lab Reagents

Human IgG antibody Laboratories manufactures the antibodies rrm2b mouse reagents distributed by Genprice. The Antibodies Rrm2B Mouse reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact mouse Antibody. Other Antibodies products are available in stock. Specificity: Antibodies Category: Rrm2B Group: Mouse

Mouse information

RRM2B Antibody

CSB-PA277130-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RRM2B. Recognizes RRM2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RRM2B Antibody

1-CSB-PA745339ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RRM2B. Recognizes RRM2B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

RRM2B Antibody

1-CSB-PA745339ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RRM2B. Recognizes RRM2B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

Rrm2b ORF Vector (Mouse) (pORF)

ORF056464 1.0 ug DNA
EUR 506

RRM2B Conjugated Antibody

C35321 100ul
EUR 397

RRM2B Blocking Peptide

20-abx161723
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RRM2B Rabbit pAb

A5516-100ul 100 ul
EUR 308

RRM2B Rabbit pAb

A5516-200ul 200 ul
EUR 459

RRM2B Rabbit pAb

A5516-20ul 20 ul Ask for price

RRM2B Rabbit pAb

A5516-50ul 50 ul Ask for price

RRM2B Rabbit pAb

A8020-100ul 100 ul
EUR 308

RRM2B Rabbit pAb

A8020-200ul 200 ul
EUR 459

RRM2B Rabbit pAb

A8020-20ul 20 ul
EUR 183

RRM2B Rabbit pAb

A8020-50ul 50 ul
EUR 223

RRM2B Blocking Peptide

DF4826-BP 1mg
EUR 195

RRM2B cloning plasmid

CSB-CL745339HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1056
  • Sequence: atgggcgacccggaaaggccggaagcggccgggctggatcaggatgagagatcatcttcagacaccaacgaaagtgaaataaagtcaaatgaagagccactcctaagaaagagttctcgccggtttgtcatctttccaatccagtaccctgatatttggaaaatgtataaacagg
  • Show more
Description: A cloning plasmid for the RRM2B gene.

Anti-RRM2B antibody

STJ110326 100 µl
EUR 277
Description: This gene encodes the small subunit of a p53-inducible ribonucleotide reductase. This heterotetrameric enzyme catalyzes the conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates. The product of this reaction is necessary for DNA synthesis. Mutations in this gene have been associated with autosomal recessive mitochondrial DNA depletion syndrome, autosomal dominant progressive external ophthalmoplegia-5, and mitochondrial neurogastrointestinal encephalopathy. Alternatively spliced transcript variants have been described.