A sandwich quantitative ELISA assay kit for detection of Mouse Transmembrane

Comparability of Business ELISA Kits, a Prototype Multiplex Electrochemoluminescent Assay, and a Multiplex Bead-Primarily based Immunoassay for Detecting a Urine-Primarily based Bladder-Most cancers-Related Diagnostic Signature.

 

 

  • The flexibility to precisely measure a number of proteins concurrently in a single assay has the potential to markedly enhance the effectivity of medical checks composed of a number of biomarkers. We investigated the diagnostic accuracy of the 2 multiplex protein array platforms for detecting a bladder-cancer-associated diagnostic signature in samples from a cohort of 80 topics (40 with bladder most cancers). Banked urine samples collected from Kyoto and Nara Universities have been in contrast to histologically decided bladder cancer.

 

  • The concentrations of the 10 proteins (A1AT; apolipoprotein E-APOE; angiogenin-ANG; carbonic anhydrase 9-CA9; interleukin 8-IL-8; matrix metalloproteinase 9-MMP-9; matrix metalloproteinase 10-MMP10; plasminogen activator inhibitor 1-PAI-1; syndecan-SDC1; and vascular endothelial progress factor-VEGF) have been monitored utilizing two prototype multiplex array platforms and an enzyme-linked immunosorbent assay (ELISA) in keeping with the producer’s technical specs.

Rat Transmembrane Protein 27 (TMEM27) ELISA Kit

  • The vary for detecting every biomarker was improved within the multiplex assays, regardless that the decrease restrict of quantification (LLOQ) was usually decrease within the business ELISA kits. The world underneath the receiver working traits (AUROC) of the prototype multiplex assays was reported to be 0.97 for the multiplex bead-based b(MBA) and 0.86 for the multiplex electrochemoluminescent assay (MEA).

 

  • The sensitivities and specificities for MBA have been 0.93 and 0.95, respectively, and for MEA have been 0.85 and 0.80, respectively. Accuracy, optimistic predictive values (PPV), and unfavourable predictive values (NPV) for MBA have been 0.94, 0.95, and 0.93, respectively, and for MEA have been 0.83, 0.81, and 0.84, respectively. Primarily based on these encouraging preliminary information, we imagine {that a} multiplex protein array is a viable platform that may be utilized as an environment friendly and extremely correct software to quantitate a number of proteins inside biologic specimens.

Human Transmembrane Protein 27 (TMEM27) ELISA Kit

Human Transmembrane Protein 27 (TMEM27) ELISA Kit

RDR-TMEM27-Hu-96Tests 96 Tests
EUR 756

Human Transmembrane Protein 27 (TMEM27) ELISA Kit

RD-TMEM27-Hu-48Tests 48 Tests
EUR 521

Human Transmembrane Protein 27 (TMEM27) ELISA Kit

RD-TMEM27-Hu-96Tests 96 Tests
EUR 723

Mouse Transmembrane Protein 27 (TMEM27) ELISA Kit

DLR-TMEM27-Mu-48T 48T
EUR 527
  • Should the Mouse Transmembrane Protein 27 (TMEM27) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transmembrane Protein 27 (TMEM27) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Transmembrane Protein 27 (TMEM27) ELISA Kit

DLR-TMEM27-Mu-96T 96T
EUR 688
  • Should the Mouse Transmembrane Protein 27 (TMEM27) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transmembrane Protein 27 (TMEM27) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Transmembrane Protein 27 (TMEM27) ELISA Kit

DLR-TMEM27-Ra-48T 48T
EUR 549
  • Should the Rat Transmembrane Protein 27 (TMEM27) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transmembrane Protein 27 (TMEM27) in samples from tissue homogenates or other biological fluids.

Rat Transmembrane Protein 27 (TMEM27) ELISA Kit

DLR-TMEM27-Ra-96T 96T
EUR 718
  • Should the Rat Transmembrane Protein 27 (TMEM27) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transmembrane Protein 27 (TMEM27) in samples from tissue homogenates or other biological fluids.

Mouse Transmembrane Protein 27 (TMEM27) ELISA Kit

RDR-TMEM27-Mu-48Tests 48 Tests
EUR 557

Mouse Transmembrane Protein 27 (TMEM27) ELISA Kit

RDR-TMEM27-Mu-96Tests 96 Tests
EUR 774

Rat Transmembrane Protein 27 (TMEM27) ELISA Kit

RDR-TMEM27-Ra-48Tests 48 Tests
EUR 583

Rat Transmembrane Protein 27 (TMEM27) ELISA Kit

RDR-TMEM27-Ra-96Tests 96 Tests
EUR 811

Mouse Transmembrane Protein 27 (TMEM27) ELISA Kit

RD-TMEM27-Mu-48Tests 48 Tests
EUR 533

Mouse Transmembrane Protein 27 (TMEM27) ELISA Kit

RD-TMEM27-Mu-96Tests 96 Tests
EUR 740

Rat Transmembrane Protein 27 (TMEM27) ELISA Kit

RD-TMEM27-Ra-48Tests 48 Tests
EUR 557

Rat Transmembrane Protein 27 (TMEM27) ELISA Kit

RD-TMEM27-Ra-96Tests 96 Tests
EUR 775

Human Transmembrane Protein 27 (TMEM27)ELISA Kit

201-12-2411 96 tests
EUR 440
  • This Transmembrane Protein 27 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Transmembrane Protein 27 (TMEM27) ELISA Kit

20-abx153314
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Transmembrane Protein 27(TMEM27)ELISA Kit

QY-E02429 96T
EUR 361

Human Transmembrane Protein 27 (TMEM27) ELISA Kit

SEK477Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 27 (TMEM27) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 27 (TMEM27) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Transmembrane Protein 27 (TMEM27) ELISA Kit

SEK477Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 27 (TMEM27) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 27 (TMEM27) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Transmembrane Protein 27 (TMEM27) ELISA Kit

SEK477Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 27 (TMEM27) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 27 (TMEM27) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Transmembrane Protein 27 (TMEM27) ELISA Kit

SEK477Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 27 (TMEM27) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 27 (TMEM27) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Transmembrane Protein 27 (TMEM27) ELISA Kit

4-SEK477Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transmembrane Protein 27 elisa. Alternative names of the recognized antigen: NX17
  • Collectrin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transmembrane Protein 27 (TMEM27) in samples from Tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Transmembrane Protein 27 (TMEM27) Protein

20-abx069449
  • EUR 537.00
  • EUR 244.00
  • EUR 1553.00
  • EUR 634.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Transmembrane Protein 27 (TMEM27) Antibody

20-abx178706
  • EUR 1358.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.

Transmembrane Protein 27 (TMEM27) Antibody

20-abx102698
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transmembrane Protein 27 (TMEM27) Antibody

20-abx129603
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transmembrane Protein 27 (TMEM27) Antibody

20-abx129887
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transmembrane Protein 27 (TMEM27) Antibody

20-abx131398
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transmembrane Protein 27 (TMEM27) Antibody

20-abx132010
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transmembrane Protein 27 (TMEM27) Antibody

20-abx174917
  • EUR 356.00
  • EUR 913.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transmembrane Protein 27 (TMEM27) Antibody

20-abx174918
  • EUR 940.00
  • EUR 481.00
  • 1 mg
  • 200 ug
  • Please enquire.

Transmembrane Protein 27 (TMEM27) Antibody

abx238776-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Transmembrane Protein 27 (TMEM27) Antibody

abx238777-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Transmembrane Protein 27 (TMEM27) Antibody

abx238778-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Transmembrane Protein 27 (TMEM27) Antibody

20-abx301714
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transmembrane Protein 27 (TMEM27) Antibody

20-abx002497
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Transmembrane Protein 27 (TMEM27)

4-RPK477Hu01
  • EUR 377.76
  • EUR 204.00
  • EUR 1141.60
  • EUR 447.20
  • EUR 794.40
  • EUR 316.00
  • EUR 2704.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9HBJ8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.3kDa
  • Isoelectric Point: 7.9
Description: Recombinant Human Transmembrane Protein 27 expressed in: E.coli

Recombinant Transmembrane Protein 27 (TMEM27)

4-RPK477Mu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9ESG4
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.7kDa
  • Isoelectric Point: 6.1
Description: Recombinant Mouse Transmembrane Protein 27 expressed in: E.coli

Recombinant Transmembrane Protein 27 (TMEM27)

4-RPK477Mu02
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9ESG4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Transmembrane Protein 27 expressed in: E.coli

Recombinant Transmembrane Protein 27 (TMEM27)

4-RPK477Ra01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9ESG3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Transmembrane Protein 27 expressed in: E.coli

Dog Transmembrane Protein 27 (TMEM27) ELISA Kit

20-abx150296
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Transmembrane Protein 27 (TMEM27) ELISA Kit

20-abx156161
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Transmembrane Protein 27 (TMEM27) ELISA Kit

20-abx154768
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Transmembrane Protein 27(TMEM27)ELISA Kit

QY-E10445 96T
EUR 361

Business Milk Enzyme-Linked Immunosorbent Assay (ELISAPackage Reactivities to Purified Milk Proteins and Milk-Derived Substances.

  • Quite a few business enzyme-linked immunosorbent assay (ELISA) kits exist to quantitatively detect bovine milk residues in meals. Milk accommodates many proteins that may function ELISA targets together with caseins (α-, β-, or κ-casein) and whey proteins (α-lactalbumin or β-lactoglobulin).

 

  • 9 commercially-available milk ELISA kits have been chosen to check the specificity and sensitivity with 5 purified milk proteins and three milk-derived elements.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

  • The entire milk kits have been able to quantifying nonfat dry milk (NFDM), however didn’t essentially detect all particular person protein fractions. Whereas milk-derived elements have been detected by the kits, their quantitation could also be inaccurate as a consequence of using completely different calibrators, reference supplies, and antibodies in equipment growth.

 

  • The institution of a typical reference materials for the calibration of milk ELISA kits is more and more essential. The suitable choice and understanding of milk ELISA kits for meals evaluation is critical to correct quantification of milk residues and knowledgeable threat management selections.
Transmembrane Protein 5 (TMEM5) Antibody
abx238783-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Human Transmembrane Protein 5 (TMEM5)ELISA Kit
201-12-2414 96 tests
EUR 440
  • This Transmembrane Protein 5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Transmembrane protein 5 (TMEM5) ELISA Kit
abx383824-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Transmembrane protein 5, TMEM5 ELISA KIT
ELI-41877h 96 Tests
EUR 824
Human Transmembrane Protein 5(TMEM5)ELISA Kit
QY-E02427 96T
EUR 361
Mouse Transmembrane protein 5, Tmem5 ELISA KIT
ELI-51691m 96 Tests
EUR 865
Rat Transmembrane Protein 5(TMEM5)ELISA Kit
QY-E10444 96T
EUR 361
Mouse Transmembrane Protein 5(TMEM5)ELISA Kit
QY-E21515 96T
EUR 361
TMEM5 ELISA KIT|Human
EF003685 96 Tests
EUR 689
TMEM5 Recombinant Protein (Human)
RP032194 100 ug Ask for price
TMEM5 antibody
20R-TR022 50 ug
EUR 656
Description: Rabbit polyclonal TMEM5 antibody
TMEM5 antibody
20R-TR023 50 ug
EUR 656
Description: Rabbit polyclonal TMEM5 antibody
TMEM5 antibody
20R-TR024 50 ug
EUR 656
Description: Rabbit polyclonal TMEM5 antibody
TMEM5 siRNA
20-abx937407
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TMEM5 siRNA
20-abx937408
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TMEM5 Recombinant Protein (Rat)
RP233807 100 ug Ask for price
TMEM5 Recombinant Protein (Mouse)
RP179795 100 ug Ask for price
Human TMEM5 shRNA Plasmid
20-abx957002
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Human Transmembrane channel- like protein 5, TMC5 ELISA KIT
ELI-45963h 96 Tests
EUR 824
TMEM5 cloning plasmid
CSB-CL023848HU-10ug 10ug
EUR 482
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1332
  • Sequence: atgcggctgacgcggaagcggctctgctcgtttcttatcgccctgtactgcctattctccctctacgctgcctaccacgtcttcttcgggcgccgccgccaggcgccggccgggtccccgcggggcctcaggaagggggcggcccccgcgcgggagagacgcggccgagaacagt
  • Show more
Description: A cloning plasmid for the TMEM5 gene.
anti- TMEM5 antibody
FNab08783 100µg
EUR 548.75
  • Immunogen: transmembrane protein 5
  • Uniprot ID: Q9Y2B1
  • Gene ID: 10329
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against TMEM5
Anti-TMEM5 antibody
PAab08783 100 ug
EUR 386
TMEM5 ORF Vector (Human) (pORF)
ORF010732 1.0 ug DNA
EUR 95
Human Transmembrane Protease, Serine 5 (TMPRSS5) ELISA Kit
abx383843-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Transmembrane protease serine 5, TMPRSS5 ELISA KIT
ELI-41888h 96 Tests
EUR 824
TMEM5 Protein Vector (Human) (pPB-C-His)
PV042925 500 ng
EUR 329
TMEM5 Protein Vector (Human) (pPB-N-His)
PV042926 500 ng
EUR 329
TMEM5 Protein Vector (Human) (pPM-C-HA)
PV042927 500 ng
EUR 329
TMEM5 Protein Vector (Human) (pPM-C-His)
PV042928 500 ng
EUR 329
Recombinant human Transmembrane emp24 domain-containing protein 5
P1796 100ug Ask for price
  • Uniprot ID: Q9Y3A6
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Transmembrane emp24 domain-containing protein 5
Mouse TMEM5 shRNA Plasmid
20-abx980998
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Transmembrane channel- like protein 5, Tmc5 ELISA KIT
ELI-29403m 96 Tests
EUR 865
Lysosomal-Associated Transmembrane Protein 5 (LAPTM5) Antibody
abx025582-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Lysosomal-Associated Transmembrane Protein 5 (LAPTM5) Antibody
abx025582-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Interferon-Induced Transmembrane Protein 5 (IFITM5) Antibody
abx026061-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Interferon-Induced Transmembrane Protein 5 (IFITM5) Antibody
abx026061-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Lysosomal-Associated Transmembrane Protein 5 (LAPTM5) Antibody
20-abx307047
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Interferon-Induced Transmembrane Protein 5 (IFITM5) Antibody
20-abx312820
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TMEM5 sgRNA CRISPR Lentivector set (Human)
K2386501 3 x 1.0 ug
EUR 339
5-Formylcytosine (5-fC) ELISA Kit
MET-5102-5 5 x 96 assays
EUR 2283
5-Carboxylcytosine (5-caC) ELISA Kit
MET-5103-5 5 x 96 assays
EUR 2283
Mouse Transmembrane protease serine 5, Tmprss5 ELISA KIT
ELI-22987m 96 Tests
EUR 865
Human CKLF like MARVEL transmembrane domain containing protein 5(CMTM5) ELISA kit
E01C1835-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CKLF like MARVEL transmembrane domain containing protein 5(CMTM5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CKLF like MARVEL transmembrane domain containing protein 5(CMTM5) ELISA kit
E01C1835-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CKLF like MARVEL transmembrane domain containing protein 5(CMTM5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CKLF like MARVEL transmembrane domain containing protein 5(CMTM5) ELISA kit
E01C1835-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CKLF like MARVEL transmembrane domain containing protein 5(CMTM5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
TMEM5 Protein Vector (Rat) (pPB-C-His)
PV311746 500 ng
EUR 603
TMEM5 Protein Vector (Rat) (pPB-N-His)
PV311747 500 ng
EUR 603
TMEM5 Protein Vector (Rat) (pPM-C-HA)
PV311748 500 ng
EUR 603
  • The mouse bioassay (MBA) is the one accepted customary method for detection of botulinum neurotoxins (BoNTs) in meals. The ELISA methodology has a number of benefits over the MBA and is due to this fact extensively used for in vitro detection of BoNTs.

Human Transmembrane channel- like protein 5, TMC5 ELISA KIT

  • The US Meals and Drug Administration (FDA) and the Facilities for Illness Management and Prevention (CDC) carried out a precollaborative examine to judge the applicability of Botulinum Toxin ELISA kits for the detection of BoNT serotypes A, B, E, and F in a wide range of meals matrices.

 

  • On this examine, meals samples (e.g., broccoli, salami, smoked salmon, inexperienced beans, orange juice, tomato juice, low-fat plain yogurt, entire milk, liquid toddler formulation milk, and liquid eggs) have been spiked with excessive, medium, and low focus BoNT serotypes A, B, E, and F. Samples (unspiked and spiked) have been examined at each laboratories by the ELISA kits.

Human Transmembrane Protease, Serine 5 (TMPRSS5) ELISA Kit

  • All meals samples have been positive for BoNTs by ELISA in each laboratories at medium and excessive spiking ranges; a optimistic ELISA end in low spiked samples was each serotype and laboratory dependent. Total, the ELISA methodology seems to be an efficient preliminary screening methodology for BoNT detection in meals matrices.