A sandwich quantitative ELISA assay kit for detection of Mouse Transmembrane

• Quite a few business enzyme-linked immunosorbent assay (ELISA) kits exist to quantitatively detect bovine milk residues in meals. Milk accommodates many proteins that may function ELISA targets together with caseins (α-, β-, or κ-casein) and whey proteins (α-lactalbumin or β-lactoglobulin).

 

• 9 commercially-available milk ELISA kits have been chosen to check the specificity and sensitivity with 5 purified milk proteins and three milk-derived elements.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

• The entire milk kits have been able to quantifying nonfat dry milk (NFDM), however didn’t essentially detect all particular person protein fractions. Whereas milk-derived elements have been detected by the kits, their quantitation could also be inaccurate as a consequence of using completely different calibrators, reference supplies, and antibodies in equipment growth.

 

• The institution of a typical reference materials for the calibration of milk ELISA kits is more and more essential. The suitable choice and understanding of milk ELISA kits for meals evaluation is critical to correct quantification of milk residues and knowledgeable threat management selections.

Transmembrane Protein 5 (TMEM5) Antibody
abx238783-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Human Transmembrane Protein 5 (TMEM5)ELISA Kit
201-12-2414	SunredBio	96 tests	EUR 440
This Transmembrane Protein 5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Transmembrane protein 5 (TMEM5) ELISA Kit
abx383824-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Transmembrane protein 5, TMEM5 ELISA KIT
ELI-41877h	Lifescience Market	96 Tests	EUR 824

Human Transmembrane Protein 5(TMEM5)ELISA Kit
QY-E02427	Qayee Biotechnology	96T	EUR 361

Mouse Transmembrane protein 5, Tmem5 ELISA KIT
ELI-51691m	Lifescience Market	96 Tests	EUR 865

Rat Transmembrane Protein 5(TMEM5)ELISA Kit
QY-E10444	Qayee Biotechnology	96T	EUR 361

Mouse Transmembrane Protein 5(TMEM5)ELISA Kit
QY-E21515	Qayee Biotechnology	96T	EUR 361

TMEM5 ELISA KIT|Human
EF003685	Lifescience Market	96 Tests	EUR 689

TMEM5 Recombinant Protein (Human)
RP032194	ABM	100 ug	Ask for price

TMEM5 antibody
20R-TR022	Fitzgerald	50 ug	EUR 656
Description: Rabbit polyclonal TMEM5 antibody

TMEM5 antibody
20R-TR023	Fitzgerald	50 ug	EUR 656
Description: Rabbit polyclonal TMEM5 antibody

TMEM5 antibody
20R-TR024	Fitzgerald	50 ug	EUR 656
Description: Rabbit polyclonal TMEM5 antibody

TMEM5 siRNA
20-abx937407	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMEM5 siRNA
20-abx937408	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMEM5 Recombinant Protein (Rat)
RP233807	ABM	100 ug	Ask for price

TMEM5 Recombinant Protein (Mouse)
RP179795	ABM	100 ug	Ask for price

Human TMEM5 shRNA Plasmid
20-abx957002	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Transmembrane channel- like protein 5, TMC5 ELISA KIT
ELI-45963h	Lifescience Market	96 Tests	EUR 824

TMEM5 cloning plasmid
CSB-CL023848HU-10ug	Cusabio	10ug	EUR 482
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1332 Sequence: atgcggctgacgcggaagcggctctgctcgtttcttatcgccctgtactgcctattctccctctacgctgcctaccacgtcttcttcgggcgccgccgccaggcgccggccgggtccccgcggggcctcaggaagggggcggcccccgcgcgggagagacgcggccgagaacagt Show more
Description: A cloning plasmid for the TMEM5 gene.

anti- TMEM5 antibody
FNab08783	FN Test	100µg	EUR 548.75
Immunogen: transmembrane protein 5 Uniprot ID: Q9Y2B1 Gene ID: 10329 Research Area: Cell Division and Proliferation
Description: Antibody raised against TMEM5

Anti-TMEM5 antibody
PAab08783	Lifescience Market	100 ug	EUR 386

TMEM5 ORF Vector (Human) (pORF)
ORF010732	ABM	1.0 ug DNA	EUR 95

Human Transmembrane Protease, Serine 5 (TMPRSS5) ELISA Kit
abx383843-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Transmembrane protease serine 5, TMPRSS5 ELISA KIT
ELI-41888h	Lifescience Market	96 Tests	EUR 824

TMEM5 Protein Vector (Human) (pPB-C-His)
PV042925	ABM	500 ng	EUR 329

TMEM5 Protein Vector (Human) (pPB-N-His)
PV042926	ABM	500 ng	EUR 329

TMEM5 Protein Vector (Human) (pPM-C-HA)
PV042927	ABM	500 ng	EUR 329

TMEM5 Protein Vector (Human) (pPM-C-His)
PV042928	ABM	500 ng	EUR 329

Recombinant human Transmembrane emp24 domain-containing protein 5
P1796	FN Test	100ug	Ask for price
Uniprot ID: Q9Y3A6 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Transmembrane emp24 domain-containing protein 5

Mouse TMEM5 shRNA Plasmid
20-abx980998	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Transmembrane channel- like protein 5, Tmc5 ELISA KIT
ELI-29403m	Lifescience Market	96 Tests	EUR 865

Lysosomal-Associated Transmembrane Protein 5 (LAPTM5) Antibody
abx025582-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Lysosomal-Associated Transmembrane Protein 5 (LAPTM5) Antibody
abx025582-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Interferon-Induced Transmembrane Protein 5 (IFITM5) Antibody
abx026061-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Interferon-Induced Transmembrane Protein 5 (IFITM5) Antibody
abx026061-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Lysosomal-Associated Transmembrane Protein 5 (LAPTM5) Antibody
20-abx307047	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Interferon-Induced Transmembrane Protein 5 (IFITM5) Antibody
20-abx312820	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TMEM5 sgRNA CRISPR Lentivector set (Human)
K2386501	ABM	3 x 1.0 ug	EUR 339

5-Formylcytosine (5-fC) ELISA Kit
MET-5102-5	Cell Biolabs	5 x 96 assays	EUR 2283

5-Carboxylcytosine (5-caC) ELISA Kit
MET-5103-5	Cell Biolabs	5 x 96 assays	EUR 2283

Mouse Transmembrane protease serine 5, Tmprss5 ELISA KIT
ELI-22987m	Lifescience Market	96 Tests	EUR 865

Human CKLF like MARVEL transmembrane domain containing protein 5(CMTM5) ELISA kit
E01C1835-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CKLF like MARVEL transmembrane domain containing protein 5(CMTM5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CKLF like MARVEL transmembrane domain containing protein 5(CMTM5) ELISA kit
E01C1835-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CKLF like MARVEL transmembrane domain containing protein 5(CMTM5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CKLF like MARVEL transmembrane domain containing protein 5(CMTM5) ELISA kit
E01C1835-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CKLF like MARVEL transmembrane domain containing protein 5(CMTM5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TMEM5 Protein Vector (Rat) (pPB-C-His)
PV311746	ABM	500 ng	EUR 603

TMEM5 Protein Vector (Rat) (pPB-N-His)
PV311747	ABM	500 ng	EUR 603

TMEM5 Protein Vector (Rat) (pPM-C-HA)
PV311748	ABM	500 ng	EUR 603

• The mouse bioassay (MBA) is the one accepted customary method for detection of botulinum neurotoxins (BoNTs) in meals. The ELISA methodology has a number of benefits over the MBA and is due to this fact extensively used for in vitro detection of BoNTs.

Human Transmembrane channel- like protein 5, TMC5 ELISA KIT

• The US Meals and Drug Administration (FDA) and the Facilities for Illness Management and Prevention (CDC) carried out a precollaborative examine to judge the applicability of Botulinum Toxin ELISA kits for the detection of BoNT serotypes A, B, E, and F in a wide range of meals matrices.

 

• On this examine, meals samples (e.g., broccoli, salami, smoked salmon, inexperienced beans, orange juice, tomato juice, low-fat plain yogurt, entire milk, liquid toddler formulation milk, and liquid eggs) have been spiked with excessive, medium, and low focus BoNT serotypes A, B, E, and F. Samples (unspiked and spiked) have been examined at each laboratories by the ELISA kits.

Human Transmembrane Protease, Serine 5 (TMPRSS5) ELISA Kit

• All meals samples have been positive for BoNTs by ELISA in each laboratories at medium and excessive spiking ranges; a optimistic ELISA end in low spiked samples was each serotype and laboratory dependent. Total, the ELISA methodology seems to be an efficient preliminary screening methodology for BoNT detection in meals matrices.