Eef1A1 Mouse Monoclonal Upstate Biotechnology

Lab Reagents

Human IgG antibody Laboratories manufactures the eef1a1 mouse monoclonal upstate biotechnology reagents distributed by Genprice. The Eef1A1 Mouse Monoclonal Upstate Biotechnology reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact . Other Eef1A1 products are available in stock. Specificity: Eef1A1 Category: Mouse Group: Monoclonal Upstate

Monoclonal Upstate information

EEF1A1 antibody

70R-17000 50 ul
EUR 435
Description: Rabbit polyclonal EEF1A1 antibody

EEF1A1 antibody

70R-1029 100 ug
EUR 377
Description: Rabbit polyclonal EEF1A1 antibody raised against the C terminal of EEF1A1

EEF1A1 Antibody

DF6156 200ul
EUR 304
Description: EEF1A1 Antibody detects endogenous levels of total EEF1A1.

EEF1A1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EEF1A1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


YF-PA23621 50 ul
EUR 334
Description: Mouse polyclonal to eEF1A1

Eef1a1 ORF Vector (Mouse) (pORF)

ORF043633 1.0 ug DNA
EUR 506

EEF1A1 ELISA Kit (Mouse) (OKEH05651)

OKEH05651 96 Wells
EUR 779
Description: Description of target: This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis. With PARP1 and TXK, forms a complex that acts as a T helper 1 (Th1) cell-specific transcription factor and binds the promoter of IFN-gamma to directly regulate its transcription, and is thus involved importantly in Th1 cytokine production.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL

eEF1A1 Conjugated Antibody

C49856 100ul
EUR 397

EEF1A1 Conjugated Antibody

C32103 100ul
EUR 397

EEF1A1 cloning plasmid

CSB-CL007409HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1389
  • Sequence: atgggaaaggaaaagactcatatcaacattgtcgtcattggacacgtagattcgggcaagtccaccactactggccatctgatctataaatgcggtggcatcgacaaaagaaccattgaaaaatttgagaaggaggctgctgagatgggaaagggctccttcaagtatgcctggg
  • Show more
Description: A cloning plasmid for the EEF1A1 gene.

anti- EEF1A1 antibody

FNab02641 100µg
EUR 548.75
  • Immunogen: eukaryotic translation elongation factor 1 alpha 1
  • Uniprot ID: P68104
  • Gene ID: 1915
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against EEF1A1

eEF1A1 Rabbit mAb

A11545-100ul 100 ul
EUR 410

eEF1A1 Rabbit mAb

A11545-200ul 200 ul
EUR 571

eEF1A1 Rabbit mAb

A11545-20ul 20 ul
EUR 221

eEF1A1 Rabbit mAb

A11545-50ul 50 ul
EUR 287

EEF1A1 Rabbit pAb

A0831-100ul 100 ul
EUR 308